Transcript: Mouse NM_001113352.2

Mus musculus synaptojanin 2 (Synj2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Synj2 (20975)
Length:
5751
CDS:
172..4476

Additional Resources:

NCBI RefSeq record:
NM_001113352.2
NBCI Gene record:
Synj2 (20975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113352.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080615 CGGGTGACACACCTATGATAA pLKO.1 1151 CDS 100% 13.200 10.560 N Synj2 n/a
2 TRCN0000288183 CGGGTGACACACCTATGATAA pLKO_005 1151 CDS 100% 13.200 10.560 N Synj2 n/a
3 TRCN0000295481 GGGAATTATGGGACGATTATT pLKO_005 2929 CDS 100% 15.000 10.500 N Synj2 n/a
4 TRCN0000080614 GCACAGAACTTATGCAGACTT pLKO.1 2906 CDS 100% 4.950 3.465 N Synj2 n/a
5 TRCN0000288246 GCACAGAACTTATGCAGACTT pLKO_005 2906 CDS 100% 4.950 3.465 N Synj2 n/a
6 TRCN0000080616 GCTAAATTCAAAGCCCATCAT pLKO.1 1410 CDS 100% 4.950 3.465 N Synj2 n/a
7 TRCN0000050377 CCCACCTACAAGTATGACGTT pLKO.1 2503 CDS 100% 2.640 1.848 N SYNJ2 n/a
8 TRCN0000080617 CCAAGGCTAGAACTGGAATAA pLKO.1 3488 CDS 100% 13.200 7.920 N Synj2 n/a
9 TRCN0000298409 CCAAGGCTAGAACTGGAATAA pLKO_005 3488 CDS 100% 13.200 7.920 N Synj2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113352.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.