Transcript: Mouse NM_001113533.1

Mus musculus Wilms tumour 1-associating protein (Wtap), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Wtap (60532)
Length:
2051
CDS:
192..1382

Additional Resources:

NCBI RefSeq record:
NM_001113533.1
NBCI Gene record:
Wtap (60532)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124350 CCTGGAAGTTTACGCCTGATA pLKO.1 622 CDS 100% 4.950 6.930 N Wtap n/a
2 TRCN0000124352 CCGACTGAGTGAAACAGACTT pLKO.1 224 CDS 100% 4.950 3.960 N Wtap n/a
3 TRCN0000331380 GGAAAGTACACAGATCTTAAT pLKO_005 315 CDS 100% 13.200 9.240 N Wtap n/a
4 TRCN0000306167 GGTGAACTGGAACAGACTAAA pLKO_005 567 CDS 100% 13.200 9.240 N Wtap n/a
5 TRCN0000231426 TTTGTGTAGGGTCAAGTTATT pLKO_005 1615 3UTR 100% 13.200 9.240 N WTAP n/a
6 TRCN0000124353 GACCCAGCAATCAACTTGTTT pLKO.1 531 CDS 100% 5.625 3.938 N Wtap n/a
7 TRCN0000124351 GCACGGGATGAGTTAATTCTA pLKO.1 255 CDS 100% 5.625 3.938 N Wtap n/a
8 TRCN0000326134 GCACGGGATGAGTTAATTCTA pLKO_005 255 CDS 100% 5.625 3.938 N Wtap n/a
9 TRCN0000001075 GAGAAAGCAGTGAGTGGGAAA pLKO.1 1284 CDS 100% 4.050 2.835 N WTAP n/a
10 TRCN0000001076 TCGAATGCTTATCCAGGAGAA pLKO.1 674 CDS 100% 4.050 2.835 N WTAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02205 pDONR223 100% 35.5% 37.8% None (many diffs) n/a
2 ccsbBroad304_02205 pLX_304 0% 35.5% 37.8% V5 (many diffs) n/a
3 TRCN0000472743 TCTCTAGTGGTGCGCTGTTTATAC pLX_317 100% 35.5% 37.8% V5 (many diffs) n/a
Download CSV