Transcript: Mouse NM_001113735.1

Mus musculus predicted gene 13057 (Gm13057), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Gm13057 (100040861)
Length:
2104
CDS:
29..1519

Additional Resources:

NCBI RefSeq record:
NM_001113735.1
NBCI Gene record:
Gm13057 (100040861)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113735.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284642 ATGCTGAAGTCACTGATAAAT pLKO_005 1843 3UTR 100% 15.000 7.500 Y Gm13040 n/a
2 TRCN0000272205 CCTCTCAGTTATGCCTTATAT pLKO_005 1443 CDS 100% 15.000 7.500 Y Gm13057 n/a
3 TRCN0000281867 CGTCCCTGACATGACAATATT pLKO_005 286 CDS 100% 15.000 7.500 Y Gm13057 n/a
4 TRCN0000272202 TGCACTGAGGCGACGTTTAAA pLKO_005 496 CDS 100% 15.000 7.500 Y Gm13040 n/a
5 TRCN0000270654 TGCCATTGTTGCCAGTAAATA pLKO_005 1502 CDS 100% 15.000 7.500 Y Gm13101 n/a
6 TRCN0000270416 ACGTCCCTGACATGACAATAT pLKO_005 285 CDS 100% 13.200 6.600 Y Gm13043 n/a
7 TRCN0000270113 ATGCACTGAGGCGACGTTTAA pLKO_005 495 CDS 100% 13.200 6.600 Y Pramef25 n/a
8 TRCN0000270464 CTCTGTTGGCCACCTACATAT pLKO_005 1925 3UTR 100% 13.200 6.600 Y Gm13043 n/a
9 TRCN0000270463 GCAACACGCCCTCATAGTTAT pLKO_005 476 CDS 100% 13.200 6.600 Y Gm13043 n/a
10 TRCN0000284643 GTCTTGTGCCTCTCGGAATTT pLKO_005 1092 CDS 100% 13.200 6.600 Y Gm13040 n/a
11 TRCN0000270111 TTGCCATTGTTGCCAGTAAAT pLKO_005 1501 CDS 100% 13.200 6.600 Y Pramef25 n/a
12 TRCN0000272204 AGATCAAGAATCTTCGTAAAC pLKO_005 759 CDS 100% 10.800 5.400 Y Gm13040 n/a
13 TRCN0000272208 CAACACGCCCTCATAGTTATG pLKO_005 477 CDS 100% 10.800 5.400 Y Gm13057 n/a
14 TRCN0000270461 CAGATCAAGAATCTTCGTAAA pLKO_005 758 CDS 100% 10.800 5.400 Y Gm13043 n/a
15 TRCN0000198804 CCAGCTGATCATGGAGCTTTA pLKO.1 1300 CDS 100% 10.800 5.400 Y Gm13119 n/a
16 TRCN0000281924 CTGGCAGACACACGAAGATAC pLKO_005 207 CDS 100% 10.800 5.400 Y Gm13057 n/a
17 TRCN0000272164 CTTCACTGTAGGATGCTATTC pLKO_005 1889 3UTR 100% 10.800 5.400 Y Gm13057 n/a
18 TRCN0000284640 TACAGAGCCTGGCGAAGAATG pLKO_005 114 CDS 100% 10.800 5.400 Y Gm13040 n/a
19 TRCN0000270462 TGAGGAGTTGGAATTGCATAT pLKO_005 691 CDS 100% 10.800 5.400 Y Gm13043 n/a
20 TRCN0000176469 CCTTGGAATTAGAACATTGTA pLKO.1 1143 CDS 100% 5.625 2.813 Y Gm13119 n/a
21 TRCN0000181386 CCAAGAAAGAGGAAGCTTCAA pLKO.1 356 CDS 100% 4.950 2.475 Y BC080695 n/a
22 TRCN0000178636 CCACGAGAAACTCTTCACTTT pLKO.1 796 CDS 100% 4.950 2.475 Y Gm13119 n/a
23 TRCN0000181264 CGAGGTCAACTTCTGTGACAA pLKO.1 1225 CDS 100% 4.950 2.475 Y Gm13119 n/a
24 TRCN0000177434 CGTAAACTCCATCTAACACTA pLKO.1 773 CDS 100% 4.950 2.475 Y Gm13119 n/a
25 TRCN0000270174 GATTCGTTTGGTAACTGAGAA pLKO_005 1530 3UTR 100% 4.950 2.475 Y Pramef25 n/a
26 TRCN0000181810 GCTTTCTTCTGAGCTCATGAA pLKO.1 1381 CDS 100% 4.950 2.475 Y BC080695 n/a
27 TRCN0000177350 GAAATGAAAGTCTAAGGACAA pLKO.1 1548 3UTR 100% 4.050 2.025 Y Gm13119 n/a
28 TRCN0000182436 GCTGGACTTGAACTCATGCTT pLKO.1 1808 3UTR 100% 3.000 1.500 Y BC080695 n/a
29 TRCN0000182741 CCAGAGAGAATTGTCCAGCTT pLKO.1 1364 CDS 100% 2.640 1.320 Y BC080695 n/a
30 TRCN0000200371 GTCCTAACGAACCTTCTGCAT pLKO.1 1262 CDS 100% 2.640 1.320 Y BC080695 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113735.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.