Transcript: Human NM_001114132.1

Homo sapiens neurobeachin like 1 (NBEAL1), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
NBEAL1 (65065)
Length:
9058
CDS:
334..8418

Additional Resources:

NCBI RefSeq record:
NM_001114132.1
NBCI Gene record:
NBEAL1 (65065)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001114132.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262291 AGGGATGGAACGGTGATTATA pLKO_005 7867 CDS 100% 15.000 21.000 N NBEAL1 n/a
2 TRCN0000143117 CCATATCGGAATTGGAGACAT pLKO.1 817 CDS 100% 4.950 6.930 N NBEAL1 n/a
3 TRCN0000157787 CGACTGCCTATCCATTGTGTT pLKO.1 8212 CDS 100% 4.950 6.930 N NBEAL1 n/a
4 TRCN0000145019 GAAAGATCCAGATTACCTGAA pLKO.1 384 CDS 100% 4.050 5.670 N NBEAL1 n/a
5 TRCN0000151804 CCTAAAGGTCATTGTATCCAT pLKO.1 8631 3UTR 100% 3.000 4.200 N NBEAL1 n/a
6 TRCN0000152094 CTCGGTGAAAGTTACAAGTTT pLKO.1 8901 3UTR 100% 5.625 4.500 N NBEAL1 n/a
7 TRCN0000262292 ACAATTTGCTGTGGTATATAA pLKO_005 8544 3UTR 100% 15.000 10.500 N NBEAL1 n/a
8 TRCN0000262290 AGACTCAAACACACCATTATT pLKO_005 4344 CDS 100% 15.000 10.500 N NBEAL1 n/a
9 TRCN0000249521 ATGGCAGGACGAACCTATAAT pLKO_005 6403 CDS 100% 15.000 10.500 N Nbeal1 n/a
10 TRCN0000282182 ATGGCAGGACGAACCTATAAT pLKO_005 6403 CDS 100% 15.000 10.500 N NBEAL1 n/a
11 TRCN0000262293 CAAACACCCTGTCAATTATTA pLKO_005 7144 CDS 100% 15.000 10.500 N NBEAL1 n/a
12 TRCN0000152932 CGGAAGAGTTGGACCTTAATA pLKO.1 6473 CDS 100% 15.000 10.500 N NBEAL1 n/a
13 TRCN0000262296 GATTACTGAAACCTGATTTAT pLKO_005 8442 3UTR 100% 15.000 10.500 N NBEAL1 n/a
14 TRCN0000249525 GTGATGGTATTCCACTATTAA pLKO_005 7292 CDS 100% 15.000 10.500 N Nbeal1 n/a
15 TRCN0000262294 AGATCACCACAGGAGTTATTC pLKO_005 6307 CDS 100% 13.200 9.240 N NBEAL1 n/a
16 TRCN0000262289 CAGACTGAAATCTACTCATTT pLKO_005 5218 CDS 100% 13.200 9.240 N NBEAL1 n/a
17 TRCN0000262288 GAGATCACTTCTAAGCTATTT pLKO_005 7525 CDS 100% 13.200 9.240 N NBEAL1 n/a
18 TRCN0000262295 TCGGAAGAGTTGGACCTTAAT pLKO_005 6472 CDS 100% 13.200 9.240 N NBEAL1 n/a
19 TRCN0000143702 GATGATATGCCTCCAGGAATA pLKO.1 481 CDS 100% 10.800 7.560 N NBEAL1 n/a
20 TRCN0000150906 GCTACAGATTACTGTGGAATA pLKO.1 7675 CDS 100% 10.800 7.560 N NBEAL1 n/a
21 TRCN0000157473 GCCGACTGTTGTCACTTCATT pLKO.1 6263 CDS 100% 5.625 3.938 N NBEAL1 n/a
22 TRCN0000150393 CATACAAGGATTCCTGTCTAT pLKO.1 8145 CDS 100% 4.950 3.465 N NBEAL1 n/a
23 TRCN0000156779 GCCAGATTTCAGCTGGAGAAA pLKO.1 8369 CDS 100% 4.950 3.465 N NBEAL1 n/a
24 TRCN0000140350 CCTCCAGGAATATCTCTGCTT pLKO.1 490 CDS 100% 2.640 1.848 N NBEAL1 n/a
25 TRCN0000144418 CCTGATAATATTCTGCAGGTT pLKO.1 511 CDS 100% 2.640 1.848 N NBEAL1 n/a
26 TRCN0000140927 CCAGGAATATCTCTGCTTCCT pLKO.1 493 CDS 100% 0.264 0.185 N NBEAL1 n/a
27 TRCN0000144576 GAATATCTCTGCTTCCTGATA pLKO.1 497 CDS 100% 4.950 2.970 N NBEAL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114132.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.