Transcript: Human NM_001114134.1

Homo sapiens erythrocyte membrane protein band 4.2 (EPB42), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
EPB42 (2038)
Length:
2464
CDS:
301..2376

Additional Resources:

NCBI RefSeq record:
NM_001114134.1
NBCI Gene record:
EPB42 (2038)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001114134.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434986 ATCTCAGTGACGCTGGTTAAT pLKO_005 1777 CDS 100% 13.200 18.480 N EPB42 n/a
2 TRCN0000117232 GCGTCTTCTCATAGATGAATA pLKO.1 1200 CDS 100% 13.200 18.480 N EPB42 n/a
3 TRCN0000434826 CTGCACCCAAGTGCTCCTAAT pLKO_005 1345 CDS 100% 10.800 8.640 N EPB42 n/a
4 TRCN0000117235 CCCAAGCCACATTCCCAATTT pLKO.1 524 CDS 100% 13.200 9.240 N EPB42 n/a
5 TRCN0000433370 ACACTCTGAATCCAACCTTAG pLKO_005 2007 CDS 100% 6.000 4.200 N EPB42 n/a
6 TRCN0000117233 CCTCTGTACCTGCTCTTGAAA pLKO.1 1720 CDS 100% 5.625 3.938 N EPB42 n/a
7 TRCN0000117234 CGAGGACATCACTCAGAACTA pLKO.1 1584 CDS 100% 4.950 3.465 N EPB42 n/a
8 TRCN0000117236 GCTCAGGAAGACATTGCCATT pLKO.1 2035 CDS 100% 4.050 2.835 N EPB42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114134.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00506 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00506 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471963 ACGCAATGGTGGATGTGTCTTCTG pLX_317 17.2% 100% 100% V5 n/a
Download CSV