Transcript: Human NM_001114309.2

Homo sapiens E74 like ETS transcription factor 3 (ELF3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ELF3 (1999)
Length:
3218
CDS:
243..1358

Additional Resources:

NCBI RefSeq record:
NM_001114309.2
NBCI Gene record:
ELF3 (1999)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001114309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013863 CTCCCTAATTTATGTGCTATA pLKO.1 1825 3UTR 100% 10.800 15.120 N ELF3 n/a
2 TRCN0000413810 GAACTGAGGGTTGGAACTATA pLKO_005 1352 CDS 100% 13.200 10.560 N ELF3 n/a
3 TRCN0000424403 AGATGTACATAGAGATCTATT pLKO_005 1856 3UTR 100% 13.200 9.240 N ELF3 n/a
4 TRCN0000013865 GCCATGAGGTACTACTACAAA pLKO.1 1236 CDS 100% 5.625 3.938 N ELF3 n/a
5 TRCN0000013867 CAACTACTTCAGTGCGATGTA pLKO.1 278 CDS 100% 4.950 3.465 N ELF3 n/a
6 TRCN0000054415 CCAAGTGGAGAAGAACAAGTA pLKO.1 476 CDS 100% 4.950 3.465 N Elf3 n/a
7 TRCN0000013864 CCGAAAGCTGAGCAAAGAGTA pLKO.1 992 CDS 100% 4.950 3.465 N ELF3 n/a
8 TRCN0000013866 GCTCTTCTGATGAGCTCAGTT pLKO.1 634 CDS 100% 4.950 2.970 N ELF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13852 pDONR223 100% 99.9% 99.7% None 1109delG n/a
2 ccsbBroad304_13852 pLX_304 0% 99.9% 99.7% V5 (not translated due to frame shift) 1109delG n/a
3 TRCN0000475086 TGACCTAACGTTTGTTCGTAATGG pLX_317 15.5% 99.9% 99.7% V5 (not translated due to frame shift) 1109delG n/a
Download CSV