Transcript: Human NM_001114598.2

Homo sapiens aspartate dehydrogenase domain containing (ASPDH), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
ASPDH (554235)
Length:
1069
CDS:
91..942

Additional Resources:

NCBI RefSeq record:
NM_001114598.2
NBCI Gene record:
ASPDH (554235)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001114598.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263273 CAAATCCTGCGCCATGCCAAT pLKO_005 346 CDS 100% 4.050 5.670 N ASPDH n/a
2 TRCN0000281585 TGATACCAGCCTCACGGACAT pLKO_005 735 CDS 100% 4.050 5.670 N ASPDH n/a
3 TRCN0000263274 CCTTGCACTGTGCTCTACGAA pLKO_005 601 CDS 100% 3.000 4.200 N ASPDH n/a
4 TRCN0000263275 CCCTGATCTGGTTGTGGAAGT pLKO_005 291 CDS 100% 4.050 2.835 N ASPDH n/a
5 TRCN0000263276 CCGCGAAATTCCAACACCATG pLKO_005 652 CDS 100% 4.050 2.835 N ASPDH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114598.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10184 pDONR223 100% 61.5% 57.9% None (many diffs) n/a
2 ccsbBroad304_10184 pLX_304 0% 61.5% 57.9% V5 (many diffs) n/a
3 TRCN0000472804 GTGATACCTCCTTCTCCCGACCCA pLX_317 76.5% 61.5% 57.9% V5 (many diffs) n/a
Download CSV