Transcript: Human NM_001118887.2

Homo sapiens angiopoietin 2 (ANGPT2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
ANGPT2 (285)
Length:
5268
CDS:
312..1799

Additional Resources:

NCBI RefSeq record:
NM_001118887.2
NBCI Gene record:
ANGPT2 (285)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001118887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059226 GCCGCAGCCTATAACAACTTT pLKO.1 357 CDS 100% 5.625 3.938 N ANGPT2 n/a
2 TRCN0000059223 CCCTAATTCTACAGAAGAGAT pLKO.1 1214 CDS 100% 4.950 3.465 N ANGPT2 n/a
3 TRCN0000059227 GATGATAGAAATAGGGACAAA pLKO.1 680 CDS 100% 4.950 3.465 N ANGPT2 n/a
4 TRCN0000059224 GCCACGGTGAATAATTCAGTT pLKO.1 1020 CDS 100% 4.950 3.465 N ANGPT2 n/a
5 TRCN0000059225 GCTTACTCATTGTATGAACAT pLKO.1 1455 CDS 100% 4.950 3.465 N ANGPT2 n/a
6 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3141 3UTR 100% 4.950 2.475 Y ORAI2 n/a
7 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3138 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001118887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05815 pDONR223 100% 99.6% 99.7% None 735G>A;799_800insCAG;1104T>C n/a
2 ccsbBroad304_05815 pLX_304 0% 99.6% 99.7% V5 735G>A;799_800insCAG;1104T>C n/a
3 TRCN0000474740 GGAAGCTCTCATTGTGTGTAAGCC pLX_317 37.4% 99.6% 99.7% V5 735G>A;799_800insCAG;1104T>C n/a
Download CSV