Transcript: Human NM_001122681.2

Homo sapiens SH3 domain binding protein 2 (SH3BP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SH3BP2 (6452)
Length:
9006
CDS:
59..1744

Additional Resources:

NCBI RefSeq record:
NM_001122681.2
NBCI Gene record:
SH3BP2 (6452)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001122681.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438605 GGGCTGTTGCCTCCAATAAAG pLKO_005 2163 3UTR 100% 13.200 18.480 N SH3BP2 n/a
2 TRCN0000444439 CCAACTCGGTCTTCGTCAACA pLKO_005 1419 CDS 100% 4.950 6.930 N SH3BP2 n/a
3 TRCN0000118719 CTCTAACAAAGTGAGGAACTA pLKO.1 1570 CDS 100% 4.950 6.930 N SH3BP2 n/a
4 TRCN0000118721 GCGAAGTGGAAAGGTTGTTCA pLKO.1 1452 CDS 100% 4.950 3.960 N SH3BP2 n/a
5 TRCN0000445767 GACTCTACTGCATCCGGAACT pLKO_005 1506 CDS 100% 4.050 2.835 N SH3BP2 n/a
6 TRCN0000118718 GAAGACTATGAGCACGACGAT pLKO.1 572 CDS 100% 2.640 1.848 N SH3BP2 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3793 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3793 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122681.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.