Transcript: Human NM_001122821.2

Homo sapiens SET nuclear proto-oncogene (SET), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SET (6418)
Length:
2708
CDS:
104..976

Additional Resources:

NCBI RefSeq record:
NM_001122821.2
NBCI Gene record:
SET (6418)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001122821.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063713 GCTGAAATTAAATGCCACTTT pLKO.1 2472 3UTR 100% 4.950 3.465 N SET n/a
2 TRCN0000063717 CCACCGAAATCAAATGGAAAT pLKO.1 606 CDS 100% 10.800 6.480 N SET n/a
3 TRCN0000288709 CCACCGAAATCAAATGGAAAT pLKO_005 606 CDS 100% 10.800 6.480 N SET n/a
4 TRCN0000077183 CCAACATGTATCTGTCTACTT pLKO.1 1424 3UTR 100% 4.950 2.970 N Set n/a
5 TRCN0000063715 CCAGAGTTGAAGTGACAGAAT pLKO.1 465 CDS 100% 4.950 2.970 N SET n/a
6 TRCN0000288673 CCAGAGTTGAAGTGACAGAAT pLKO_005 465 CDS 100% 4.950 2.970 N SET n/a
7 TRCN0000063716 GCGATTGAACACATTGATGAA pLKO.1 233 CDS 100% 4.950 2.970 N SET n/a
8 TRCN0000288611 GCGATTGAACACATTGATGAA pLKO_005 233 CDS 100% 4.950 2.970 N SET n/a
9 TRCN0000425634 ATCAGGTTACAGAATAGATTT pLKO_005 499 CDS 100% 13.200 6.600 Y Set n/a
10 TRCN0000063714 GAAGAAGATGATGATGATGAT pLKO.1 839 CDS 100% 4.950 2.475 Y SET n/a
11 TRCN0000288612 GAAGAAGATGATGATGATGAT pLKO_005 839 CDS 100% 4.950 2.475 Y SET n/a
12 TRCN0000077186 GAGAGCTTCTTTACCTGGTTT pLKO.1 701 CDS 100% 4.950 2.475 Y Set n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122821.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01519 pDONR223 100% 90.5% 89.6% None (many diffs) n/a
2 ccsbBroad304_01519 pLX_304 0% 90.5% 89.6% V5 (many diffs) n/a
3 TRCN0000474477 TCAGCCTACCATCAACTTCGTATT pLX_317 68% 90.5% 89.6% V5 (many diffs) n/a
Download CSV