Transcript: Human NM_001122964.3

Homo sapiens protein phosphatase 4 regulatory subunit 3B (PPP4R3B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
PPP4R3B (57223)
Length:
5506
CDS:
338..2887

Additional Resources:

NCBI RefSeq record:
NM_001122964.3
NBCI Gene record:
PPP4R3B (57223)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001122964.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219969 TCGCTTTATGAGGCGGATAAT pLKO.1 2110 CDS 100% 13.200 18.480 N PPP4R3B n/a
2 TRCN0000374655 TGAACAGTGTACCATCTATAT pLKO_005 2406 CDS 100% 13.200 18.480 N Ppp4r3b n/a
3 TRCN0000149086 GTAATGTGTTACGGGTCCATT pLKO.1 4150 3UTR 100% 4.950 6.930 N PPP4R3B n/a
4 TRCN0000215466 GATCAGCTGCTACAGATATAT pLKO.1 1476 CDS 100% 15.000 10.500 N Ppp4r3b n/a
5 TRCN0000215574 GATGAAGAAATGTGGTTTAAT pLKO.1 2471 CDS 100% 15.000 10.500 N Ppp4r3b n/a
6 TRCN0000426918 TTGATTGCTTGCTAGTAATTA pLKO_005 3065 3UTR 100% 15.000 10.500 N PPP4R3B n/a
7 TRCN0000219968 AGTACATTCAGGACATCATTT pLKO.1 1146 CDS 100% 13.200 9.240 N PPP4R3B n/a
8 TRCN0000366198 AGTACATTCAGGACATCATTT pLKO_005 1146 CDS 100% 13.200 9.240 N Ppp4r3b n/a
9 TRCN0000418244 AGTCTCTTACTGCCCATATAG pLKO_005 2283 CDS 100% 13.200 9.240 N PPP4R3B n/a
10 TRCN0000183749 CCTGGAATCGTTTAATCTAAA pLKO.1 4174 3UTR 100% 13.200 9.240 N PPP4R3B n/a
11 TRCN0000425033 CTAAGAGAGTTTAGTTCTAAT pLKO_005 3022 3UTR 100% 13.200 9.240 N PPP4R3B n/a
12 TRCN0000366121 GGGACTTCTTCGTACTCTAAT pLKO_005 1651 CDS 100% 13.200 9.240 N Ppp4r3b n/a
13 TRCN0000425019 TTGGTTGGCTTAGTGGATTAT pLKO_005 2798 CDS 100% 13.200 9.240 N PPP4R3B n/a
14 TRCN0000183522 GACCAATACTTCAGAAGACAA pLKO.1 1774 CDS 100% 4.950 3.465 N PPP4R3B n/a
15 TRCN0000148384 CCAACCAAGAATAGTGCTGAA pLKO.1 3773 3UTR 100% 4.050 2.835 N PPP4R3B n/a
16 TRCN0000149294 GCTGTTCAGTTAATGGGACTT pLKO.1 1637 CDS 100% 4.050 2.835 N PPP4R3B n/a
17 TRCN0000219970 GATAATGGAACTCGGTATAAT pLKO.1 2207 CDS 100% 15.000 9.000 N PPP4R3B n/a
18 TRCN0000179416 CCTTGAATATGACCCTGCTTT pLKO.1 1012 CDS 100% 4.950 2.970 N PPP4R3B n/a
19 TRCN0000183123 CGATTGAATATGTTCAGACAT pLKO.1 2331 CDS 100% 4.950 2.475 Y PPP4R3B n/a
20 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 4954 3UTR 100% 4.950 2.475 Y C16orf89 n/a
21 TRCN0000145323 GAAGATGAAGAAGAGGAAGAT pLKO.1 2492 CDS 100% 4.950 2.475 Y ARMH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122964.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.