Transcript: Human NM_001127181.2

Homo sapiens centromere protein L (CENPL), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
CENPL (91687)
Length:
2693
CDS:
604..1776

Additional Resources:

NCBI RefSeq record:
NM_001127181.2
NBCI Gene record:
CENPL (91687)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127181.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433972 TTCAGTCCTTTAGCAATCAAT pLKO_005 1363 CDS 100% 5.625 7.875 N CENPL n/a
2 TRCN0000136142 GCAGAAACGATTAGAATCGGT pLKO.1 684 CDS 100% 0.750 1.050 N CENPL n/a
3 TRCN0000416671 CTGACTCCACCTCGAAGGAAA pLKO_005 727 CDS 100% 4.950 3.960 N CENPL n/a
4 TRCN0000415780 ACTTCAACATCAAAGTGATTT pLKO_005 944 CDS 100% 13.200 9.240 N CENPL n/a
5 TRCN0000412316 CTGTGTCATAAATACCTTATT pLKO_005 1708 CDS 100% 13.200 9.240 N CENPL n/a
6 TRCN0000424759 GTGGACTTTATATAGTTTAAC pLKO_005 816 CDS 100% 13.200 9.240 N CENPL n/a
7 TRCN0000419816 TTCACATTTCCATAGACATTT pLKO_005 1605 CDS 100% 13.200 9.240 N CENPL n/a
8 TRCN0000428134 CACAAGATTAGTTCGTGTTTC pLKO_005 1644 CDS 100% 10.800 7.560 N CENPL n/a
9 TRCN0000135696 CCAGGAAGAAGTTGACCTATT pLKO.1 1569 CDS 100% 10.800 7.560 N CENPL n/a
10 TRCN0000426382 GCCTAATTGCTATGCTGAAAG pLKO_005 1827 3UTR 100% 10.800 7.560 N CENPL n/a
11 TRCN0000136105 CCTCTGCAGAAACGATTAGAA pLKO.1 679 CDS 100% 5.625 3.938 N CENPL n/a
12 TRCN0000135286 CTTCAGCACATACTGATGGAA pLKO.1 1676 CDS 100% 3.000 2.100 N CENPL n/a
13 TRCN0000134136 CATATTTGACAGAACTGGCAA pLKO.1 1739 CDS 100% 2.640 1.848 N CENPL n/a
14 TRCN0000135446 GCATCTATCTCTGCATCTGTT pLKO.1 1866 3UTR 100% 4.950 2.970 N CENPL n/a
15 TRCN0000136382 CACCTGTAATTCCAGCACTTT pLKO.1 2084 3UTR 100% 4.950 2.475 Y CENPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127181.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04555 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04555 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480952 ACACTGTAATCGTGCTCTATTGGG pLX_317 36.6% 100% 100% V5 n/a
Download CSV