Transcript: Human NM_001127217.2

Homo sapiens SMAD family member 9 (SMAD9), transcript variant a, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SMAD9 (4093)
Length:
5592
CDS:
344..1747

Additional Resources:

NCBI RefSeq record:
NM_001127217.2
NBCI Gene record:
SMAD9 (4093)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127217.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019446 CACGGCTTTGAAGTCGTGTAT pLKO.1 1541 CDS 100% 4.950 6.930 N SMAD9 n/a
2 TRCN0000019445 CGACCCTTCAAATAACAGGAA pLKO.1 1249 CDS 100% 2.640 3.696 N SMAD9 n/a
3 TRCN0000412684 GCGATATTGTCAACAGTATTT pLKO_005 2001 3UTR 100% 13.200 10.560 N SMAD9 n/a
4 TRCN0000019447 GCAGAAAGAAGTGTGCATTAA pLKO.1 703 CDS 100% 13.200 9.240 N SMAD9 n/a
5 TRCN0000434453 GTCTTAACAGTCATGTCTTAA pLKO_005 1741 CDS 100% 13.200 9.240 N SMAD9 n/a
6 TRCN0000019448 CGTGTATGAACTGACCAAGAT pLKO.1 1555 CDS 100% 4.950 3.465 N SMAD9 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4180 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4180 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127217.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00965 pDONR223 100% 92% 92% None 669_779del n/a
2 ccsbBroad304_00965 pLX_304 0% 92% 92% V5 669_779del n/a
3 TRCN0000480230 TCTCGAACATTAGCTTCACAAGTC pLX_317 30.1% 92% 92% V5 669_779del n/a
Download CSV