Transcript: Mouse NM_001127338.1

Mus musculus aldehyde dehydrogenase family 7, member A1 (Aldh7a1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Mus musculus (mouse)
Gene:
Aldh7a1 (110695)
Length:
3105
CDS:
353..1888

Additional Resources:

NCBI RefSeq record:
NM_001127338.1
NBCI Gene record:
Aldh7a1 (110695)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001127338.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042076 CGGAGAAATAGTCAGAAAGAT pLKO.1 598 CDS 100% 5.625 3.938 N Aldh7a1 n/a
2 TRCN0000308498 CGGAGAAATAGTCAGAAAGAT pLKO_005 598 CDS 100% 5.625 3.938 N Aldh7a1 n/a
3 TRCN0000042074 CCCAATCCTCTATGTCTTCAA pLKO.1 1558 CDS 100% 4.950 3.465 N Aldh7a1 n/a
4 TRCN0000308582 CCCAATCCTCTATGTCTTCAA pLKO_005 1558 CDS 100% 4.950 3.465 N Aldh7a1 n/a
5 TRCN0000042073 GCTCTCATCGAAATGTGGAAT pLKO.1 797 CDS 100% 4.950 3.465 N Aldh7a1 n/a
6 TRCN0000308512 GCTCTCATCGAAATGTGGAAT pLKO_005 797 CDS 100% 4.950 3.465 N Aldh7a1 n/a
7 TRCN0000042075 GTGCCATTTGTTCCCTGGTTT pLKO.1 1002 CDS 100% 4.950 3.465 N Aldh7a1 n/a
8 TRCN0000308510 GTGCCATTTGTTCCCTGGTTT pLKO_005 1002 CDS 100% 4.950 3.465 N Aldh7a1 n/a
9 TRCN0000042077 GCTTGGAGGAAACAATGCCAT pLKO.1 1156 CDS 100% 2.640 1.848 N Aldh7a1 n/a
10 TRCN0000308511 GCTTGGAGGAAACAATGCCAT pLKO_005 1156 CDS 100% 2.640 1.848 N Aldh7a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127338.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.