Transcript: Mouse NM_001127346.1

Mus musculus NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2 (Ndufaf2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ndufaf2 (75597)
Length:
696
CDS:
57..563

Additional Resources:

NCBI RefSeq record:
NM_001127346.1
NBCI Gene record:
Ndufaf2 (75597)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001127346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254241 ACTGGAGAGGGCAGACTATTC pLKO_005 175 CDS 100% 10.800 15.120 N Ndufaf2 n/a
2 TRCN0000265502 ACTACTACGTCGCCGAGTACA pLKO_005 151 CDS 100% 4.950 6.930 N Ndufaf2 n/a
3 TRCN0000254239 CCACCCACTATGGAGGAAATA pLKO_005 300 CDS 100% 13.200 10.560 N Ndufaf2 n/a
4 TRCN0000254242 CCTACTGCAACTCAAGTTAAA pLKO_005 423 CDS 100% 13.200 9.240 N Ndufaf2 n/a
5 TRCN0000254240 CCGAGTGGGAAGCATGGATTA pLKO_005 262 CDS 100% 10.800 7.560 N Ndufaf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04564 pDONR223 100% 84.9% 81% None (many diffs) n/a
2 ccsbBroad304_04564 pLX_304 0% 84.9% 81% V5 (many diffs) n/a
3 TRCN0000478900 ATTGCTGCCCGTAGTTTCGGACCC pLX_317 87% 84.9% 81% V5 (many diffs) n/a
Download CSV