Transcript: Human NM_001127384.2

Homo sapiens catenin alpha 3 (CTNNA3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-03-19
Taxon:
Homo sapiens (human)
Gene:
CTNNA3 (29119)
Length:
10663
CDS:
151..2838

Additional Resources:

NCBI RefSeq record:
NM_001127384.2
NBCI Gene record:
CTNNA3 (29119)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164157 CACGGGTGAAATGGACAGTTA pLKO.1 1803 CDS 100% 4.950 6.930 N CTNNA3 n/a
2 TRCN0000160465 CCTGAATATTGCTTTAGACAA pLKO.1 1224 CDS 100% 4.950 6.930 N CTNNA3 n/a
3 TRCN0000160322 CGCAAGGCTATTATAGATCAT pLKO.1 1282 CDS 100% 4.950 6.930 N CTNNA3 n/a
4 TRCN0000160039 CATACAACTGATGTGATCTAT pLKO.1 2329 CDS 100% 5.625 3.938 N CTNNA3 n/a
5 TRCN0000158421 CCACTAAAGCATACAACTGAT pLKO.1 2320 CDS 100% 4.950 3.465 N CTNNA3 n/a
6 TRCN0000160161 CCTGGAACAGATTAAGTTCTA pLKO.1 2454 CDS 100% 4.950 3.465 N CTNNA3 n/a
7 TRCN0000159368 GAGATTGAGATATGGGATGAT pLKO.1 2218 CDS 100% 4.950 3.465 N CTNNA3 n/a
8 TRCN0000159814 GCTTTCAGAGTACATGAACAA pLKO.1 1176 CDS 100% 4.950 3.465 N CTNNA3 n/a
9 TRCN0000160097 CCAAATCAGAGAGATGAAATT pLKO.1 742 CDS 100% 13.200 7.920 N CTNNA3 n/a
10 TRCN0000108729 CCATCACTAGAGAAACGCCTA pLKO.1 1042 CDS 100% 2.160 1.512 N Ctnna3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11900 pDONR223 100% 57.4% 56.9% None (many diffs) n/a
2 ccsbBroad304_11900 pLX_304 0% 57.4% 56.9% V5 (many diffs) n/a
3 TRCN0000477633 TCCCACACCATACCTCTGCGGCTA pLX_317 18% 57.4% 56.9% V5 (many diffs) n/a
Download CSV