Transcript: Human NM_001127715.2

Homo sapiens syntaxin binding protein 5 (STXBP5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
STXBP5 (134957)
Length:
9352
CDS:
176..3631

Additional Resources:

NCBI RefSeq record:
NM_001127715.2
NBCI Gene record:
STXBP5 (134957)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422190 GGGCACTGAACGAGGTAATAT pLKO_005 652 CDS 100% 15.000 21.000 N STXBP5 n/a
2 TRCN0000419981 GCACTCGAAATGGAGTATATG pLKO_005 3809 3UTR 100% 13.200 18.480 N STXBP5 n/a
3 TRCN0000430495 TTAGGAAAGTTAACGTTAAAG pLKO_005 3698 3UTR 100% 13.200 18.480 N STXBP5 n/a
4 TRCN0000429624 GATGCTTGAAGTTCGATTATT pLKO_005 1798 CDS 100% 15.000 12.000 N STXBP5 n/a
5 TRCN0000434611 GTCATTGGACTGGATTATAAA pLKO_005 4064 3UTR 100% 15.000 12.000 N STXBP5 n/a
6 TRCN0000415572 GGAGCCTTGCACAGCATATTC pLKO_005 3399 CDS 100% 13.200 10.560 N STXBP5 n/a
7 TRCN0000148758 CCTCCTCTTCTCAGGAAATTA pLKO.1 2883 CDS 100% 15.000 10.500 N STXBP5 n/a
8 TRCN0000146927 CCTGGATCATTCCTGTATTAA pLKO.1 3933 3UTR 100% 15.000 10.500 N STXBP5 n/a
9 TRCN0000431626 TGCAATAACTCTACAAGTATT pLKO_005 1573 CDS 100% 13.200 9.240 N STXBP5 n/a
10 TRCN0000146824 CCAGGTTATCAAACAGAACTA pLKO.1 2006 CDS 100% 4.950 3.465 N STXBP5 n/a
11 TRCN0000149723 GCCAAGTTTAAGACCTCTGTT pLKO.1 3094 CDS 100% 4.950 3.465 N STXBP5 n/a
12 TRCN0000149119 GCACAATCTCTTGACAGAGAA pLKO.1 3341 CDS 100% 0.495 0.347 N STXBP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09557 pDONR223 100% 96.8% 96.8% None 2146_2253del;3393A>G n/a
2 ccsbBroad304_09557 pLX_304 0% 96.8% 96.8% V5 2146_2253del;3393A>G n/a
3 ccsbBroadEn_16093 pDONR223 0% 96.8% 96.7% None 1307A>G;2146_2253del;2445A>G n/a
4 ccsbBroad304_16093 pLX_304 0% 96.8% 96.7% V5 1307A>G;2146_2253del;2445A>G n/a
Download CSV