Transcript: Human NM_001127716.1

Homo sapiens electron transfer flavoprotein subunit alpha (ETFA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
ETFA (2108)
Length:
1222
CDS:
82..936

Additional Resources:

NCBI RefSeq record:
NM_001127716.1
NBCI Gene record:
ETFA (2108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293887 AGGAACTGACACCATTGATTT pLKO_005 203 CDS 100% 13.200 18.480 N ETFA n/a
2 TRCN0000293888 CAGATATTTGTGGGTATTATA pLKO_005 991 3UTR 100% 15.000 10.500 N ETFA n/a
3 TRCN0000064415 GCTTGACCAGAAATTAACAAA pLKO.1 531 CDS 100% 5.625 3.938 N ETFA n/a
4 TRCN0000286451 GCTTGACCAGAAATTAACAAA pLKO_005 531 CDS 100% 5.625 3.938 N ETFA n/a
5 TRCN0000064414 GAGAACTATTTATGCAGGAAA pLKO.1 369 CDS 100% 4.950 3.465 N ETFA n/a
6 TRCN0000064417 CCAGAACTTTATATTGCTGTT pLKO.1 748 CDS 100% 4.050 2.835 N ETFA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00518 pDONR223 100% 85.2% 85.2% None 38_39ins147 n/a
2 ccsbBroad304_00518 pLX_304 0% 85.2% 85.2% V5 38_39ins147 n/a
3 TRCN0000474746 GCTTGTAGTGTATATTCGTTTCAA pLX_317 43.9% 85.2% 85.2% V5 38_39ins147 n/a
Download CSV