Transcript: Human NM_001128215.1

Homo sapiens lipase family member M (LIPM), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
LIPM (340654)
Length:
1484
CDS:
168..1439

Additional Resources:

NCBI RefSeq record:
NM_001128215.1
NBCI Gene record:
LIPM (340654)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128215.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050720 GAATATGAAGTCGCAACTGAA pLKO.1 351 CDS 100% 4.950 3.465 N LIPM n/a
2 TRCN0000050719 CCAAGATGAGTTCTGGGCTTT pLKO.1 608 CDS 100% 4.050 2.835 N LIPM n/a
3 TRCN0000050721 CCAGGTGATTCTTGATCAGAT pLKO.1 950 CDS 100% 4.950 2.970 N LIPM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128215.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14478 pDONR223 100% 89.7% 88.6% None (many diffs) n/a
2 ccsbBroad304_14478 pLX_304 0% 89.7% 88.6% V5 (many diffs) n/a
3 TRCN0000475665 GCGTGAGCAACATAATTGGTACAT pLX_317 23.2% 89.7% 88.6% V5 (many diffs) n/a
Download CSV