Transcript: Human NM_001128830.4

Homo sapiens carbonic anhydrase 1 (CA1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CA1 (759)
Length:
1907
CDS:
170..955

Additional Resources:

NCBI RefSeq record:
NM_001128830.4
NBCI Gene record:
CA1 (759)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128830.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118608 CGCAGCCTTCTATCAAATGTT pLKO.1 851 CDS 100% 5.625 7.875 N CA1 n/a
2 TRCN0000118610 CGATAACCGATCAGTGCTGAA pLKO.1 391 CDS 100% 4.050 3.240 N CA1 n/a
3 TRCN0000421378 GATGCCCTCCAAGCAATTAAA pLKO_005 656 CDS 100% 15.000 10.500 N CA1 n/a
4 TRCN0000118607 GCCTTCAAATCAATCTGTAAA pLKO.1 1070 3UTR 100% 13.200 9.240 N CA1 n/a
5 TRCN0000118609 GCTGATGGTTTGGCAGTTATT pLKO.1 584 CDS 100% 13.200 9.240 N CA1 n/a
6 TRCN0000429353 GGGCATTCCTTCCATGTAAAT pLKO_005 359 CDS 100% 13.200 9.240 N CA1 n/a
7 TRCN0000118611 CTCTTTATGAGAGTGTAACTT pLKO.1 777 CDS 100% 5.625 3.938 N CA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128830.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00198 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00198 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473619 CCCACGATTTGAACTATATTAGTA pLX_317 66.8% 100% 100% V5 n/a
Download CSV