Transcript: Human NM_001128846.1

Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (SMARCA4), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
SMARCA4 (6597)
Length:
5326
CDS:
1..4851

Additional Resources:

NCBI RefSeq record:
NM_001128846.1
NBCI Gene record:
SMARCA4 (6597)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128846.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231100 GTACCGAGCCTCGGGTAAATT pLKO_005 3225 CDS 100% 0.000 0.000 N SMARCA4 n/a
2 TRCN0000379829 TGGAGCACAAACGCATCAATG pLKO_005 2390 CDS 100% 10.800 8.640 N SMARCA4 n/a
3 TRCN0000015548 CCATATTTATACAGCAGAGAA pLKO.1 4981 3UTR 100% 4.950 3.960 N SMARCA4 n/a
4 TRCN0000015550 GCCAAGCAAGATGTCGATGAT pLKO.1 2128 CDS 100% 4.950 3.960 N SMARCA4 n/a
5 TRCN0000380723 ACCTTCGAGCAGTGGTTTAAC pLKO_005 2812 CDS 100% 13.200 9.240 N SMARCA4 n/a
6 TRCN0000380157 CAAGATGTCGATGATGAATAT pLKO_005 2134 CDS 100% 13.200 9.240 N SMARCA4 n/a
7 TRCN0000231101 CTTTGCGTATCGCGGCTTTAA pLKO_005 3345 CDS 100% 13.200 9.240 N SMARCA4 n/a
8 TRCN0000380532 CGTACGAGTACATCATCAAAG pLKO_005 2576 CDS 100% 10.800 7.560 N SMARCA4 n/a
9 TRCN0000231099 GGACAAGCAGTCAGCGCTTAT pLKO_005 2226 CDS 100% 10.800 7.560 N SMARCA4 n/a
10 TRCN0000231102 GGCATAGGCCTTAGCAGTAAC pLKO_005 4902 3UTR 100% 10.800 7.560 N SMARCA4 n/a
11 TRCN0000218544 TCAAACAGTACCAGATCAAAG pLKO_005 2261 CDS 100% 10.800 7.560 N SMARCA4 n/a
12 TRCN0000015549 CCCGTGGACTTCAAGAAGATA pLKO.1 4417 CDS 100% 5.625 3.938 N SMARCA4 n/a
13 TRCN0000015551 CCGAGGTCTGATAGTGAAGAA pLKO.1 1957 CDS 100% 4.950 3.465 N SMARCA4 n/a
14 TRCN0000015552 CGGCAGACACTGTGATCATTT pLKO.1 3500 CDS 100% 13.200 7.920 N SMARCA4 n/a
15 TRCN0000163739 GAAGAAGAGGAAGAGGAGGAA pLKO.1 1987 CDS 100% 2.640 1.320 Y CCDC88B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128846.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.