Transcript: Human NM_001128854.2

Homo sapiens serrate, RNA effector molecule (SRRT), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SRRT (51593)
Length:
2975
CDS:
245..2860

Additional Resources:

NCBI RefSeq record:
NM_001128854.2
NBCI Gene record:
SRRT (51593)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293723 GACCGCAGTGTTAACATTAAA pLKO_005 1649 CDS 100% 15.000 21.000 N SRRT n/a
2 TRCN0000293724 TCGTGCATTCCTTGGATTATT pLKO_005 2094 CDS 100% 15.000 21.000 N SRRT n/a
3 TRCN0000306726 AGGCCGTCAAGCGCTATAATG pLKO_005 744 CDS 100% 13.200 18.480 N SRRT n/a
4 TRCN0000074647 CACGGAGAATGATCTTCGCAT pLKO.1 1024 CDS 100% 2.640 3.696 N SRRT n/a
5 TRCN0000293722 AGCGGGATGAGAAGTTGATTA pLKO_005 2040 CDS 100% 13.200 10.560 N SRRT n/a
6 TRCN0000074646 GCTGAGAATGACAGTTCTAAT pLKO.1 1187 CDS 100% 13.200 9.240 N SRRT n/a
7 TRCN0000074644 CCAGACGATGTTGATTTCTTT pLKO.1 2837 CDS 100% 5.625 3.938 N SRRT n/a
8 TRCN0000074643 GCGCAAACATATCTTCAACAA pLKO.1 2425 CDS 100% 4.950 3.465 N SRRT n/a
9 TRCN0000074645 GCCATTGTCAAGATGCTGGAT pLKO.1 977 CDS 100% 2.640 1.848 N SRRT n/a
10 TRCN0000286277 GCCATTGTCAAGATGCTGGAT pLKO_005 977 CDS 100% 2.640 1.848 N SRRT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14150 pDONR223 100% 99.9% 12.6% None 303_304insG n/a
2 ccsbBroad304_14150 pLX_304 0% 99.9% 12.6% V5 (not translated due to prior stop codon) 303_304insG n/a
3 TRCN0000471548 CGGTCCTTACCAGCTACAGATTCC pLX_317 17.1% 99.9% 12.6% V5 (not translated due to prior stop codon) 303_304insG n/a
Download CSV