Transcript: Human NM_001130064.2

Homo sapiens growth associated protein 43 (GAP43), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
GAP43 (2596)
Length:
1894
CDS:
469..1293

Additional Resources:

NCBI RefSeq record:
NM_001130064.2
NBCI Gene record:
GAP43 (2596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130064.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000447221 GCTCATAAGGCCGCAACCAAA pLKO_005 667 CDS 100% 4.950 6.930 N GAP43 n/a
2 TRCN0000047323 CGTGGACACATAACAAGGAAA pLKO.1 703 CDS 100% 4.950 3.960 N GAP43 n/a
3 TRCN0000047327 CAAGATGGTATCAAACCAGAA pLKO.1 640 CDS 100% 4.050 3.240 N GAP43 n/a
4 TRCN0000421227 GTCAAACAGTGTGGCTTAAAC pLKO_005 1492 3UTR 100% 13.200 9.240 N GAP43 n/a
5 TRCN0000047326 CCACTAAAGCTTCCACTGATA pLKO.1 1004 CDS 100% 4.950 3.465 N GAP43 n/a
6 TRCN0000047325 TGTAGATGAAACCAAACCTAA pLKO.1 1209 CDS 100% 4.950 3.465 N GAP43 n/a
7 TRCN0000047324 GCTGAAGCTAATAAGAAGGAT pLKO.1 766 CDS 100% 3.000 2.100 N GAP43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130064.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.