Transcript: Human NM_001130142.2

Homo sapiens von Willebrand factor A domain containing 5A (VWA5A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
VWA5A (4013)
Length:
4300
CDS:
164..2524

Additional Resources:

NCBI RefSeq record:
NM_001130142.2
NBCI Gene record:
VWA5A (4013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179413 CGGTTGTGAAAGCTGCTATTA pLKO.1 2460 CDS 100% 13.200 18.480 N VWA5A n/a
2 TRCN0000433158 GCGTGAACATTTACGAGTTTG pLKO_005 231 CDS 100% 10.800 15.120 N VWA5A n/a
3 TRCN0000128376 GAGAAGTTACAGACACGTTTA pLKO.1 1347 CDS 100% 10.800 8.640 N VWA5A n/a
4 TRCN0000435608 AGCTTTCATTGCTATCAATAA pLKO_005 1921 CDS 100% 13.200 9.240 N VWA5A n/a
5 TRCN0000148425 CAGGAGAAGTATGCCTCAAAT pLKO.1 1701 CDS 100% 13.200 9.240 N VWA5A n/a
6 TRCN0000428514 GACGTGGAACTCCTGATTTAC pLKO_005 842 CDS 100% 13.200 9.240 N VWA5A n/a
7 TRCN0000416291 GACATTCCAGATGGACGATTA pLKO_005 2122 CDS 100% 10.800 7.560 N VWA5A n/a
8 TRCN0000130090 CCAAGATCCTAGGTATGAGTT pLKO.1 2265 CDS 100% 4.950 3.465 N VWA5A n/a
9 TRCN0000129058 GCTGCTGAAGAGTTTACCTAT pLKO.1 1108 CDS 100% 4.950 3.465 N VWA5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00947 pDONR223 100% 52.7% 52.7% None 1246_2358del n/a
2 ccsbBroad304_00947 pLX_304 0% 52.7% 52.7% V5 1246_2358del n/a
3 TRCN0000465538 AATCGGGACTGATGGGCAGCATGG pLX_317 27.7% 52.7% 52.7% V5 1246_2358del n/a
Download CSV