Transcript: Human NM_001130417.3

Homo sapiens solute carrier family 8 member A3 (SLC8A3), transcript variant g, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
SLC8A3 (6547)
Length:
2967
CDS:
339..1235

Additional Resources:

NCBI RefSeq record:
NM_001130417.3
NBCI Gene record:
SLC8A3 (6547)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130417.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044870 CCCAAACTAGAAGTCATCATT pLKO.1 441 CDS 100% 5.625 3.938 N SLC8A3 n/a
2 TRCN0000044871 CCAGATACGTTTGCCAGCAAA pLKO.1 855 CDS 100% 4.950 3.465 N SLC8A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130417.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06963 pDONR223 100% 95.1% 95.3% None 1_42del;510C>G n/a
2 ccsbBroad304_06963 pLX_304 0% 95.1% 95.3% V5 1_42del;510C>G n/a
3 TRCN0000475701 TTGTACCCCTCCATCTAGGCTCTG pLX_317 40.9% 95.1% 95.3% V5 1_42del;510C>G n/a
Download CSV