Transcript: Human NM_001130689.1

Homo sapiens high mobility group box 2 (HMGB2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
HMGB2 (3148)
Length:
1454
CDS:
121..750

Additional Resources:

NCBI RefSeq record:
NM_001130689.1
NBCI Gene record:
HMGB2 (3148)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130689.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431522 ATGTCCTCGTACGCCTTCTTC pLKO_005 157 CDS 100% 4.950 6.930 N HMGB2 n/a
2 TRCN0000382370 CGTTCCTCCCAAAGGTGATAA pLKO_005 354 CDS 100% 13.200 10.560 N HMGB2 n/a
3 TRCN0000436275 GTGTGTGCTCAGGCAATTATT pLKO_005 785 3UTR 100% 15.000 10.500 N HMGB2 n/a
4 TRCN0000425499 AGACACAGTTGACCTAGTAAA pLKO_005 1238 3UTR 100% 13.200 9.240 N HMGB2 n/a
5 TRCN0000382406 AGAATAAATGGCTATCCTTTA pLKO_005 744 CDS 100% 10.800 7.560 N HMGB2 n/a
6 TRCN0000019012 GCCAAAGATAAACAACCATAT pLKO.1 532 CDS 100% 10.800 7.560 N HMGB2 n/a
7 TRCN0000019010 GCAAAGGAGAAGTCGAAGTTT pLKO.1 280 CDS 100% 5.625 3.938 N HMGB2 n/a
8 TRCN0000019013 CCATCTGCCTTCTTCCTGTTT pLKO.1 415 CDS 100% 4.950 3.465 N HMGB2 n/a
9 TRCN0000019011 GCAGCTAAGCTAAAGGAGAAA pLKO.1 562 CDS 100% 4.950 3.465 N HMGB2 n/a
10 TRCN0000092932 GCCAACAGGCTCAAAGAAGAA pLKO.1 651 CDS 100% 4.950 3.465 N Gm13237 n/a
11 TRCN0000019009 GCTCAATACTAGCTTCAGTAT pLKO.1 832 3UTR 100% 0.495 0.347 N HMGB2 n/a
12 TRCN0000419622 GAACACCCTGGCCTATCCATT pLKO_005 466 CDS 100% 4.950 2.970 N HMGB2 n/a
13 TRCN0000140258 GAAGATGAAGATGAGGAGGGA pLKO.1 709 CDS 100% 0.660 0.330 Y MEA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130689.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00751 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00751 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472051 TCGTGCCCACAAAACATGTAAAGT pLX_317 56.4% 100% 100% V5 n/a
Download CSV