Transcript: Human NM_001130690.2

Homo sapiens phosphodiesterase 10A (PDE10A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
PDE10A (10846)
Length:
8207
CDS:
88..2457

Additional Resources:

NCBI RefSeq record:
NM_001130690.2
NBCI Gene record:
PDE10A (10846)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130690.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005476 CGGATCACTAAACCTTAATAA pLKO.1 2040 CDS 100% 15.000 21.000 N PDE10A n/a
2 TRCN0000436072 GCCTTACACTGTGCTAATATG pLKO_005 1348 CDS 100% 13.200 18.480 N PDE10A n/a
3 TRCN0000005477 CCGATGGATTTGCACTGTATT pLKO.1 443 CDS 100% 13.200 10.560 N PDE10A n/a
4 TRCN0000005479 CCACTTTGACATTGGTCCTTT pLKO.1 1512 CDS 100% 4.950 3.960 N PDE10A n/a
5 TRCN0000430392 CCAGTTGGAAGGGCACAATAT pLKO_005 1896 CDS 100% 13.200 9.240 N PDE10A n/a
6 TRCN0000005478 CCATAAGAACAAGGAGTTATA pLKO.1 996 CDS 100% 13.200 9.240 N PDE10A n/a
7 TRCN0000005475 GCCCATCATATCAAATAACTT pLKO.1 3885 3UTR 100% 5.625 3.938 N PDE10A n/a
8 TRCN0000432530 ATGAACTAAACAGCTATATAG pLKO_005 344 CDS 100% 13.200 7.920 N PDE10A n/a
9 TRCN0000321306 TTCCTACTCGACGTATCAAAG pLKO_005 871 CDS 100% 10.800 15.120 N Pde10a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130690.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07690 pDONR223 100% 97.6% 97% None (many diffs) n/a
2 ccsbBroad304_07690 pLX_304 0% 97.6% 97% V5 (many diffs) n/a
3 TRCN0000477378 CGTGACATACTACGCATGCAACGC pLX_317 17.5% 97.6% 97% V5 (many diffs) n/a
4 TRCN0000487706 TACCGCGTATTGAGCTCGGTTCTG pLX_317 10.1% 97.6% 97% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV