Transcript: Human NM_001130699.1

Homo sapiens interaction protein for cytohesin exchange factors 1 (IPCEF1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
IPCEF1 (26034)
Length:
6858
CDS:
197..1513

Additional Resources:

NCBI RefSeq record:
NM_001130699.1
NBCI Gene record:
IPCEF1 (26034)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134161 CATTAGAGCAAGCTAGTCTAT pLKO.1 1155 CDS 100% 4.950 6.930 N IPCEF1 n/a
2 TRCN0000133991 CCGAACATTGAATAGCACATT pLKO.1 1276 CDS 100% 4.950 6.930 N IPCEF1 n/a
3 TRCN0000136672 GTCACTGTACTGGTATAGCAA pLKO.1 415 CDS 100% 3.000 4.200 N IPCEF1 n/a
4 TRCN0000138737 CGGAGGAGGATATCGTGTAAA pLKO.1 290 CDS 100% 13.200 10.560 N IPCEF1 n/a
5 TRCN0000136830 CCATCTTACTGTCCCAGATAA pLKO.1 1057 CDS 100% 13.200 9.240 N IPCEF1 n/a
6 TRCN0000136577 CAGGAAATGAACGTGTGGTTA pLKO.1 575 CDS 100% 4.950 3.465 N IPCEF1 n/a
7 TRCN0000138469 CCAGTGATGAAGCAGGAACTT pLKO.1 4859 3UTR 100% 4.950 3.465 N IPCEF1 n/a
8 TRCN0000133856 GAACGTCGTATTCTTTCTCTT pLKO.1 774 CDS 100% 4.950 3.465 N IPCEF1 n/a
9 TRCN0000134838 CCTTACATTTACACAGCACTT pLKO.1 4741 3UTR 100% 4.050 2.835 N IPCEF1 n/a
10 TRCN0000136649 GTGCAAGTTCATTCACCTGTA pLKO.1 923 CDS 100% 4.050 2.835 N IPCEF1 n/a
11 TRCN0000138793 GCAGGAAATGAACGTGTGGTT pLKO.1 574 CDS 100% 2.640 1.848 N IPCEF1 n/a
12 TRCN0000136790 CAGGAAATACAGAGAGTGGAA pLKO.1 1360 CDS 100% 2.640 1.584 N IPCEF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02906 pDONR223 100% 99.7% 99.7% None 37_39delCAG n/a
2 ccsbBroad304_02906 pLX_304 0% 99.7% 99.7% V5 37_39delCAG n/a
3 TRCN0000477169 TCCTTTGTCAGCGACACATACGAC pLX_317 32.7% 99.7% 99.7% V5 37_39delCAG n/a
Download CSV