Transcript: Human NM_001134336.2

Homo sapiens striatin interacting protein 2 (STRIP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
STRIP2 (57464)
Length:
2880
CDS:
42..2318

Additional Resources:

NCBI RefSeq record:
NM_001134336.2
NBCI Gene record:
STRIP2 (57464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134336.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446483 TGTACAGCCTTCCGCAGTATA pLKO_005 1570 CDS 100% 13.200 18.480 N STRIP2 n/a
2 TRCN0000432779 TTAAATCGGCACCAATCTTAA pLKO_005 2104 CDS 100% 13.200 18.480 N STRIP2 n/a
3 TRCN0000145390 GCTGAGTGTTATGTACCTAAT pLKO.1 647 CDS 100% 10.800 8.640 N STRIP2 n/a
4 TRCN0000416097 CCCTAAAGCAGCACAAGTATA pLKO_005 1435 CDS 100% 13.200 9.240 N STRIP2 n/a
5 TRCN0000122269 CCGAGTTGTCAGAATTGTATA pLKO.1 229 CDS 100% 13.200 9.240 N STRIP2 n/a
6 TRCN0000215324 CTAAGACAGACTCTATCAATA pLKO.1 1639 CDS 100% 13.200 9.240 N Strip2 n/a
7 TRCN0000264784 CTAAGACAGACTCTATCAATA pLKO_005 1639 CDS 100% 13.200 9.240 N Strip2 n/a
8 TRCN0000414204 TAAGCTTCTCCATGCATAATG pLKO_005 745 CDS 100% 13.200 9.240 N STRIP2 n/a
9 TRCN0000144802 GCTGCAACTTTATGTCCTAAA pLKO.1 2153 CDS 100% 10.800 7.560 N STRIP2 n/a
10 TRCN0000144412 CTACAATGAAAGGGATCTCTT pLKO.1 1112 CDS 100% 4.950 3.465 N STRIP2 n/a
11 TRCN0000143653 CTGGAGTTTGAGTATGGAGAT pLKO.1 192 CDS 100% 4.050 2.835 N STRIP2 n/a
12 TRCN0000143377 GAATGTGATTCAGAGGTCGAT pLKO.1 462 CDS 100% 2.640 1.848 N STRIP2 n/a
13 TRCN0000121875 GACATCTACAATGAAAGGGAT pLKO.1 1107 CDS 100% 2.640 1.848 N STRIP2 n/a
14 TRCN0000141806 GAGTTGGAAGAAGATGCCCAA pLKO.1 336 CDS 100% 2.160 1.512 N STRIP2 n/a
15 TRCN0000144910 GCTAAGACAGACTCTATCAAT pLKO.1 1638 CDS 100% 5.625 3.375 N STRIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134336.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03824 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03824 pLX_304 0% 100% 100% V5 n/a
Download CSV