Transcript: Human NM_001134338.3

Homo sapiens ring finger protein 24 (RNF24), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
RNF24 (11237)
Length:
7397
CDS:
136..645

Additional Resources:

NCBI RefSeq record:
NM_001134338.3
NBCI Gene record:
RNF24 (11237)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134338.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041159 GCCTACAAACAGGTTATATTA pLKO.1 373 CDS 100% 15.000 21.000 N Rnf24 n/a
2 TRCN0000004255 GTTTACTCTTCTGTTGCTACT pLKO.1 314 CDS 100% 4.050 5.670 N RNF24 n/a
3 TRCN0000004257 GAATCTGCCTCTCAACATATA pLKO.1 252 CDS 100% 13.200 9.240 N RNF24 n/a
4 TRCN0000417261 ATGTCAAGCAGGAGGGTAAAG pLKO_005 950 3UTR 100% 10.800 7.560 N RNF24 n/a
5 TRCN0000434928 TCATGAGGGTCTCTTACTAAC pLKO_005 895 3UTR 100% 10.800 7.560 N RNF24 n/a
6 TRCN0000004256 CTTATCATTTCCCTCTCCTAT pLKO.1 1293 3UTR 100% 4.950 3.465 N RNF24 n/a
7 TRCN0000004258 GTACTGCTATATTTGTCTTCA pLKO.1 287 CDS 100% 4.950 3.465 N RNF24 n/a
8 TRCN0000004254 CTGGAGGTTCGTAAAGTGTGT pLKO.1 523 CDS 100% 2.640 1.848 N RNF24 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6190 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6190 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134338.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02655 pDONR223 100% 87.5% 87.5% None 1_63del n/a
2 ccsbBroad304_02655 pLX_304 0% 87.5% 87.5% V5 1_63del n/a
3 TRCN0000472407 GGCTATGTTATACTTACGATCTGT pLX_317 89.8% 87.5% 87.5% V5 1_63del n/a
Download CSV