Transcript: Mouse NM_001134475.1

Mus musculus versican (Vcan), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Vcan (13003)
Length:
4335
CDS:
447..2414

Additional Resources:

NCBI RefSeq record:
NM_001134475.1
NBCI Gene record:
Vcan (13003)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001134475.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240556 ACTGCGGAGCACACGTAAATA pLKO_005 3384 3UTR 100% 15.000 12.000 N Vcan n/a
2 TRCN0000240555 GGTGGCCCAGAACGGAAATAT pLKO_005 698 CDS 100% 15.000 12.000 N Vcan n/a
3 TRCN0000217686 GGATGTGCTCAACCTTATTAC pLKO.1 475 CDS 100% 13.200 10.560 N Vcan n/a
4 TRCN0000175477 CTTCACTCATCATTTCAGCCA pLKO.1 2437 3UTR 100% 0.660 0.396 N Vcan n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134475.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10755 pDONR223 100% 46.2% 47.1% None (many diffs) n/a
2 ccsbBroad304_10755 pLX_304 0% 46.2% 47.1% V5 (many diffs) n/a
3 TRCN0000473729 AATCACGCGGTTTTTAGATCGTTA pLX_317 42.2% 46.2% 47.1% V5 (many diffs) n/a
Download CSV