Transcript: Human NM_001134649.2

Homo sapiens eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
EIF4E3 (317649)
Length:
6209
CDS:
460..816

Additional Resources:

NCBI RefSeq record:
NM_001134649.2
NBCI Gene record:
EIF4E3 (317649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134649.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149667 GCTCTGCTGTACCTAGTTAAT pLKO.1 1192 3UTR 100% 13.200 9.240 N EIF4E3 n/a
2 TRCN0000146957 CCAATAGGAAACCTGATGTTT pLKO.1 1616 3UTR 100% 5.625 3.938 N EIF4E3 n/a
3 TRCN0000149967 CCTTTCATTGAGGCACAAGAA pLKO.1 1152 3UTR 100% 4.950 3.465 N EIF4E3 n/a
4 TRCN0000146719 CTGGAATGTAAATGCCTCTTT pLKO.1 672 CDS 100% 4.950 3.465 N EIF4E3 n/a
5 TRCN0000147703 GTTTGGAAAGAGTTGCTGTTA pLKO.1 553 CDS 100% 4.950 3.465 N EIF4E3 n/a
6 TRCN0000148696 CCATGAAGAGCATCATGCTTT pLKO.1 771 CDS 100% 0.495 0.347 N EIF4E3 n/a
7 TRCN0000147940 GCAGCAGATGATGAAGTAATA pLKO.1 607 CDS 100% 13.200 7.920 N EIF4E3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134649.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05420 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05420 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480503 CTTCGCGTCTTCCTGCTTAGGGTG pLX_317 100% 100% 100% V5 n/a
Download CSV