Transcript: Human NM_001134875.1

Homo sapiens tubulin epsilon and delta complex 1 (TEDC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
TEDC1 (283643)
Length:
1719
CDS:
128..1408

Additional Resources:

NCBI RefSeq record:
NM_001134875.1
NBCI Gene record:
TEDC1 (283643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263795 TGGCACAACTACCTGAGGATG pLKO_005 414 CDS 100% 4.050 3.240 N TEDC1 n/a
2 TRCN0000263797 TGAGCAAGATCCACCTGTACA pLKO_005 705 CDS 100% 4.950 3.465 N TEDC1 n/a
3 TRCN0000282812 TGGGTCTTGGAGGAGCAGATT pLKO_005 1460 3UTR 100% 4.950 3.465 N TEDC1 n/a
4 TRCN0000263796 AGAGCCTTAGCCATCTGTCTG pLKO_005 747 CDS 100% 4.050 2.835 N TEDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13504 pDONR223 100% 58.2% 58.2% None 1_378del;428_583del n/a
2 ccsbBroad304_13504 pLX_304 0% 58.2% 58.2% V5 1_378del;428_583del n/a
3 TRCN0000472525 AGTACTGAGGTTTATGTCAATTTA pLX_317 59.1% 58.2% 58.2% V5 1_378del;428_583del n/a
Download CSV