Transcript: Human NM_001135697.3

Homo sapiens sarcoglycan alpha (SGCA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
SGCA (6442)
Length:
1057
CDS:
37..828

Additional Resources:

NCBI RefSeq record:
NM_001135697.3
NBCI Gene record:
SGCA (6442)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438504 ACATCCCACCTGCTGATTCCA pLKO_005 898 3UTR 100% 3.000 4.200 N SGCA n/a
2 TRCN0000053381 GCTGCCATACCAAGCCGAGTT pLKO.1 429 CDS 100% 1.350 1.890 N SGCA n/a
3 TRCN0000053378 GCCTACAATCGGGACAGCTTT pLKO.1 355 CDS 100% 4.950 3.465 N SGCA n/a
4 TRCN0000436592 ATCGTGGGCTCCAGGTCATTG pLKO_005 326 CDS 100% 3.600 2.520 N SGCA n/a
5 TRCN0000429391 CACTTGTGGGCCGTGTCTTTG pLKO_005 125 CDS 100% 3.600 2.520 N SGCA n/a
6 TRCN0000053382 CATGAGACGTTTCTGAGCCTT pLKO.1 160 CDS 100% 2.640 1.848 N SGCA n/a
7 TRCN0000053379 CCTTCCCATTGAGGGCCGAAA pLKO.1 594 CDS 100% 1.350 0.945 N SGCA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01526 pDONR223 100% 67.9% 67.9% None 583_584ins372 n/a
2 ccsbBroad304_01526 pLX_304 0% 67.9% 67.9% V5 583_584ins372 n/a
3 TRCN0000478786 TCTGTTATTACTGCCATCTCCATC pLX_317 31% 67.9% 67.9% V5 583_584ins372 n/a
Download CSV