Transcript: Human NM_001135993.2

Homo sapiens tetratricopeptide repeat domain 39C (TTC39C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TTC39C (125488)
Length:
4896
CDS:
119..1870

Additional Resources:

NCBI RefSeq record:
NM_001135993.2
NBCI Gene record:
TTC39C (125488)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417280 ACAACGACTAGAGTGTCAAAT pLKO_005 1090 CDS 100% 13.200 18.480 N TTC39C n/a
2 TRCN0000148389 CCAGTGCTATTATGCCTACTT pLKO.1 1276 CDS 100% 4.950 6.930 N TTC39C n/a
3 TRCN0000128943 CCCAGTTAAGCTGACATATTA pLKO.1 1997 3UTR 100% 15.000 10.500 N TTC39C n/a
4 TRCN0000422334 ATTTCTCTGGCTACGACTTTG pLKO_005 1785 CDS 100% 10.800 7.560 N TTC39C n/a
5 TRCN0000127768 GAGGAGGATGATGATGGTAAT pLKO.1 2064 3UTR 100% 10.800 7.560 N TTC39C n/a
6 TRCN0000130297 CGTCTATTGAAGTGTTGTACT pLKO.1 1464 CDS 100% 4.950 3.465 N TTC39C n/a
7 TRCN0000148637 CTTGACTTCTGATGCTGCAAA pLKO.1 691 CDS 100% 4.950 3.465 N TTC39C n/a
8 TRCN0000147387 GATGAATTGTGTCGTCAGAAT pLKO.1 1658 CDS 100% 4.950 3.465 N TTC39C n/a
9 TRCN0000130810 GCCATGATGACATTTGAGGAA pLKO.1 338 CDS 100% 2.640 1.848 N TTC39C n/a
10 TRCN0000416271 AGTTGGCATGTGATGACTTAA pLKO_005 369 CDS 100% 13.200 7.920 N TTC39C n/a
11 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3694 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04799 pDONR223 100% 89.4% 89.5% None 1_183del;1563C>T n/a
2 ccsbBroad304_04799 pLX_304 0% 89.4% 89.5% V5 1_183del;1563C>T n/a
3 TRCN0000470153 TCACATTCGCGATCGCCTGCACAT pLX_317 28.3% 89.4% 89.5% V5 1_183del;1563C>T n/a
Download CSV