Transcript: Human NM_001136023.3

Homo sapiens nuclear factor, erythroid 2 (NFE2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
NFE2 (4778)
Length:
1656
CDS:
272..1393

Additional Resources:

NCBI RefSeq record:
NM_001136023.3
NBCI Gene record:
NFE2 (4778)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136023.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014589 GCGCAGCGAATATGTAGAGAT pLKO.1 775 CDS 100% 4.950 6.930 N NFE2 n/a
2 TRCN0000014591 CCCATACTCCTATGGCAACAT pLKO.1 556 CDS 100% 0.495 0.693 N NFE2 n/a
3 TRCN0000014590 GCTCCAAGTGAGCCATCATTT pLKO.1 395 CDS 100% 13.200 9.240 N NFE2 n/a
4 TRCN0000430030 CACTTCCTCCACCACCTTATG pLKO_005 501 CDS 100% 10.800 7.560 N NFE2 n/a
5 TRCN0000413838 GATGACTTTAATGAGCTATTG pLKO_005 1013 CDS 100% 10.800 7.560 N NFE2 n/a
6 TRCN0000014588 GCTGATGGGATTTCCTTCATT pLKO.1 1416 3UTR 100% 5.625 3.938 N NFE2 n/a
7 TRCN0000014592 CCTGAAGAGTACGCGCTGCAA pLKO.1 1310 CDS 100% 0.880 0.616 N NFE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136023.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01089 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01089 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465520 CATACCCCTGGGACACATCATTGA pLX_317 22.9% 100% 100% V5 n/a
Download CSV