Transcript: Human NM_001136025.5

Homo sapiens plastin 3 (PLS3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PLS3 (5358)
Length:
3283
CDS:
91..1983

Additional Resources:

NCBI RefSeq record:
NM_001136025.5
NBCI Gene record:
PLS3 (5358)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136025.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056242 GCTGAGAGTATGCTTCAACAA pLKO.1 1099 CDS 100% 4.950 6.930 N PLS3 n/a
2 TRCN0000056241 GCAGATCATTAAGATCGGTTT pLKO.1 786 CDS 100% 4.050 5.670 N PLS3 n/a
3 TRCN0000056238 GCTCAGAACTTAGACGGGATT pLKO.1 2852 3UTR 100% 4.050 5.670 N PLS3 n/a
4 TRCN0000056239 GCCCTGGTAATCTTACAGTTA pLKO.1 1366 CDS 100% 4.950 3.465 N PLS3 n/a
5 TRCN0000056240 GCTGACATCAAGGATTCCAAA pLKO.1 970 CDS 100% 4.950 3.465 N PLS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136025.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01223 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01223 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470736 AATTCCACACCCAGCAGGCGCCAC pLX_317 23.2% 100% 100% V5 n/a
Download CSV