Transcript: Mouse NM_001136058.2

Mus musculus collapsin response mediator protein 1 (Crmp1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Crmp1 (12933)
Length:
3103
CDS:
88..2148

Additional Resources:

NCBI RefSeq record:
NM_001136058.2
NBCI Gene record:
Crmp1 (12933)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001136058.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032615 CCAAGTCTACATGGCGTATAA pLKO.1 921 CDS 100% 13.200 18.480 N Crmp1 n/a
2 TRCN0000032614 CCATAAATCAACTGTGGAGTA pLKO.1 1701 CDS 100% 4.050 5.670 N Crmp1 n/a
3 TRCN0000032617 GTGATCTTAGTCCATGCAGAA pLKO.1 1009 CDS 100% 4.050 5.670 N Crmp1 n/a
4 TRCN0000032616 CCTAGAAGATGGACTCATAAA pLKO.1 537 CDS 100% 13.200 9.240 N Crmp1 n/a
5 TRCN0000046777 CACCAGTCCAACTTCAGCTTA pLKO.1 2032 CDS 100% 4.950 3.465 N CRMP1 n/a
6 TRCN0000291806 CACCAGTCCAACTTCAGCTTA pLKO_005 2032 CDS 100% 4.950 3.465 N CRMP1 n/a
7 TRCN0000032618 GCCCAGATAGATGACAACAAT pLKO.1 2059 CDS 100% 5.625 3.375 N Crmp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136058.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469656 ATCGATTTATTTTAGCAGAAACGT pLX_317 21% 73.7% 78.8% V5 (many diffs) n/a
Download CSV