Transcript: Human NM_001136160.1

Homo sapiens minichromosome maintenance domain containing 2 (MCMDC2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
MCMDC2 (157777)
Length:
2048
CDS:
137..2035

Additional Resources:

NCBI RefSeq record:
NM_001136160.1
NBCI Gene record:
MCMDC2 (157777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149391 GCTTTATAGGAGACTTGGCTT pLKO.1 1359 CDS 100% 2.640 3.696 N MCMDC2 n/a
2 TRCN0000419296 CAAGTGATACTCTACTCATAG pLKO_005 1185 CDS 100% 10.800 8.640 N MCMDC2 n/a
3 TRCN0000413261 AGAATGACCCATGGCTATTAT pLKO_005 1814 CDS 100% 15.000 10.500 N MCMDC2 n/a
4 TRCN0000147266 GCAGACTGAAACGCAAATTAA pLKO.1 406 CDS 100% 15.000 10.500 N MCMDC2 n/a
5 TRCN0000150099 CTCTGTTTGTTGATGAGTCTA pLKO.1 1106 CDS 100% 4.950 3.465 N MCMDC2 n/a
6 TRCN0000146420 CTGCCAAGTTATGGTCTTGAT pLKO.1 458 CDS 100% 4.950 3.465 N MCMDC2 n/a
7 TRCN0000149097 GCTGAGCTTGGAAATCACATT pLKO.1 302 CDS 100% 4.950 3.465 N MCMDC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13302 pDONR223 100% 92.5% 92.5% None 1_15del;1770_1896delinsG n/a
2 ccsbBroad304_13302 pLX_304 0% 92.5% 92.5% V5 1_15del;1770_1896delinsG n/a
3 TRCN0000472583 ACAAATATGGCAACAGGTCCCGTA pLX_317 22.4% 92.5% 92.5% V5 1_15del;1770_1896delinsG n/a
Download CSV