Transcript: Human NM_001139510.1

Homo sapiens ethylmalonyl-CoA decarboxylase 1 (ECHDC1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-02-21
Taxon:
Homo sapiens (human)
Gene:
ECHDC1 (55862)
Length:
2131
CDS:
37..960

Additional Resources:

NCBI RefSeq record:
NM_001139510.1
NBCI Gene record:
ECHDC1 (55862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001139510.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052478 GCCTGCAAATTTAGAGGCTAT pLKO.1 912 CDS 100% 4.050 5.670 N ECHDC1 n/a
2 TRCN0000052482 GCATTACAGAACGAAAGAGAT pLKO.1 868 CDS 100% 4.950 3.960 N ECHDC1 n/a
3 TRCN0000412678 ATTTACTACAGCATGTGATTT pLKO_005 528 CDS 100% 13.200 9.240 N ECHDC1 n/a
4 TRCN0000052479 CCACAAAGAGATGGGCATAAT pLKO.1 585 CDS 100% 13.200 9.240 N ECHDC1 n/a
5 TRCN0000191025 CCTGCAAATTTAGAGGCTATT pLKO.1 913 CDS 100% 10.800 7.560 N Echdc1 n/a
6 TRCN0000412766 TATAGTACATCCCATGGATTT pLKO_005 130 CDS 100% 10.800 7.560 N ECHDC1 n/a
7 TRCN0000433408 AGTTTCCTGGTGGATCCATTG pLKO_005 182 CDS 100% 6.000 4.200 N ECHDC1 n/a
8 TRCN0000421140 ACTCTGAACAATCCAAGTAGA pLKO_005 238 CDS 100% 4.950 3.465 N ECHDC1 n/a
9 TRCN0000428313 CATTGGCATTCTTACTCTGAA pLKO_005 225 CDS 100% 4.950 3.465 N ECHDC1 n/a
10 TRCN0000414391 GCTACATCAAACAGGATTGTC pLKO_005 105 CDS 100% 4.950 3.465 N ECHDC1 n/a
11 TRCN0000052481 CCAAGTAGAATGAATGCCTTT pLKO.1 250 CDS 100% 4.050 2.835 N ECHDC1 n/a
12 TRCN0000436509 TAATAAGTGTTGCGCTGGTTC pLKO_005 479 CDS 100% 4.050 2.430 N ECHDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001139510.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03671 pDONR223 100% 98% 98% None 1_18del n/a
2 ccsbBroad304_03671 pLX_304 0% 98% 98% V5 1_18del n/a
3 TRCN0000467959 GAAAAGTACATTAACGTACGGTCC pLX_317 49.4% 98% 98% V5 1_18del n/a
Download CSV