Transcript: Human NM_001142275.1

Homo sapiens NIPA magnesium transporter 1 (NIPA1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
NIPA1 (123606)
Length:
6386
CDS:
72..836

Additional Resources:

NCBI RefSeq record:
NM_001142275.1
NBCI Gene record:
NIPA1 (123606)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142275.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250141 AGGCTCCGTCGTGCTGATTAT pLKO_005 239 CDS 100% 13.200 18.480 N NIPA1 n/a
2 TRCN0000258014 CTTGGTGTACCTTAGTATATT pLKO_005 3198 3UTR 100% 15.000 12.000 N NIPA1 n/a
3 TRCN0000250142 CCATCTACTACGTCGTGTTTA pLKO_005 631 CDS 100% 13.200 9.240 N NIPA1 n/a
4 TRCN0000146880 CAGGTGTTCAAAGAGTTCAAT pLKO.1 771 CDS 100% 5.625 3.938 N NIPA1 n/a
5 TRCN0000147766 GCCTTAACTTACTGAACTGAA pLKO.1 2987 3UTR 100% 4.950 3.465 N NIPA1 n/a
6 TRCN0000147590 GATTGTCCTTATACAGGTGTT pLKO.1 758 CDS 100% 4.050 2.835 N NIPA1 n/a
7 TRCN0000250140 GTGTTCAAAGAGTTCAATTTC pLKO_005 774 CDS 100% 13.200 7.920 N NIPA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142275.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04773 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04773 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474365 TAGACGGGCCTAACCTCCAGGAAC pLX_317 67.5% 100% 100% V5 n/a
Download CSV