Transcript: Human NM_001142589.2

Homo sapiens nuclear transcription factor Y subunit gamma (NFYC), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
NFYC (4802)
Length:
1841
CDS:
173..1066

Additional Resources:

NCBI RefSeq record:
NM_001142589.2
NBCI Gene record:
NFYC (4802)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142589.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274070 ATGATATCGCCATGGCAATTA pLKO_005 354 CDS 100% 13.200 18.480 N NFYC n/a
2 TRCN0000014984 CCACCAATGCTCAACAGATTA pLKO.1 870 CDS 100% 13.200 18.480 N NFYC n/a
3 TRCN0000274071 CGAGCCAGTCCAGTACTATTT pLKO_005 475 CDS 100% 13.200 9.240 N NFYC n/a
4 TRCN0000014983 CCTCAGATGGAATTAGGTGAA pLKO.1 1520 3UTR 100% 4.050 2.835 N NFYC n/a
5 TRCN0000274069 CCTCAGATGGAATTAGGTGAA pLKO_005 1520 3UTR 100% 4.050 2.835 N NFYC n/a
6 TRCN0000274131 TGGAAGAAATCCGGAATTTAA pLKO_005 252 CDS 100% 15.000 9.000 N NFYC n/a
7 TRCN0000014986 CATCACTAACACAGGAGAGAT pLKO.1 745 CDS 100% 4.950 2.970 N NFYC n/a
8 TRCN0000014987 CTGGCTCGTATTAAGAAGATT pLKO.1 305 CDS 100% 5.625 2.813 Y NFYC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142589.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01095 pDONR223 100% 88.6% 88.6% None 175_176ins114 n/a
2 ccsbBroad304_01095 pLX_304 0% 88.6% 88.6% V5 175_176ins114 n/a
3 TRCN0000476529 AACATTTTGATGATTCGGTTACGC pLX_317 38.9% 88.6% 88.6% V5 175_176ins114 n/a
Download CSV