Transcript: Human NM_001142864.4

Homo sapiens piezo type mechanosensitive ion channel component 1 (PIEZO1), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
PIEZO1 (9780)
Length:
8089
CDS:
257..7822

Additional Resources:

NCBI RefSeq record:
NM_001142864.4
NBCI Gene record:
PIEZO1 (9780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142864.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142281 GCACTCCATTATGTTCGAGGA pLKO.1 7645 CDS 100% 2.160 3.024 N PIEZO1 n/a
2 TRCN0000141308 CCCTGTGCATTGATTATCCCT pLKO.1 3441 CDS 100% 0.750 1.050 N PIEZO1 n/a
3 TRCN0000121969 CTCACCAAGAAGTACAATCAT pLKO.1 6536 CDS 100% 5.625 3.938 N PIEZO1 n/a
4 TRCN0000141714 GCTGCTCTGCTACTTCATCAT pLKO.1 5320 CDS 100% 4.950 3.465 N PIEZO1 n/a
5 TRCN0000141867 GTACAACGTCACCGTCATCAT pLKO.1 3916 CDS 100% 4.950 3.465 N PIEZO1 n/a
6 TRCN0000143190 GTACTTCGTGAAGTGCATCTA pLKO.1 6454 CDS 100% 4.950 3.465 N PIEZO1 n/a
7 TRCN0000142459 GAAGACCACATTCAGGTGGAA pLKO.1 5771 CDS 100% 2.640 1.848 N PIEZO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142864.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11413 pDONR223 100% 14.1% 11.2% None (many diffs) n/a
2 ccsbBroad304_11413 pLX_304 0% 14.1% 11.2% V5 (many diffs) n/a
3 TRCN0000480343 TATCAAATCCGCTGCTCACGTCTC pLX_317 41% 14.1% 11.2% V5 (many diffs) n/a
Download CSV