Transcript: Human NM_001142885.2

Homo sapiens tropomodulin 2 (TMOD2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TMOD2 (29767)
Length:
9042
CDS:
186..1133

Additional Resources:

NCBI RefSeq record:
NM_001142885.2
NBCI Gene record:
TMOD2 (29767)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142885.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428769 TCCGTTAACCACATAACTAAT pLKO_005 1235 3UTR 100% 13.200 18.480 N TMOD2 n/a
2 TRCN0000063848 GCCAACAATAAAGGTGGCAAA pLKO.1 645 CDS 100% 4.050 3.240 N TMOD2 n/a
3 TRCN0000063850 GCTGAAAGTAAACAAGACCTT pLKO.1 824 CDS 100% 2.640 2.112 N TMOD2 n/a
4 TRCN0000421722 AGCCTATAGAAACTCGTAAAG pLKO_005 493 CDS 100% 10.800 7.560 N TMOD2 n/a
5 TRCN0000432768 AGTTAGTATTGCCAATCTTTC pLKO_005 1585 3UTR 100% 10.800 7.560 N TMOD2 n/a
6 TRCN0000063851 CCAGCTGGATTTCGACAGAAA pLKO.1 324 CDS 100% 4.950 3.465 N TMOD2 n/a
7 TRCN0000063849 CCTGTCAGAAATGTTGTCAAA pLKO.1 669 CDS 100% 4.950 3.465 N TMOD2 n/a
8 TRCN0000063852 AGGAACTGAAACAGTTGGAAA pLKO.1 265 CDS 100% 4.950 2.970 N TMOD2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7679 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142885.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03091 pDONR223 100% 89.7% 89.7% None 624_625ins108 n/a
2 ccsbBroad304_03091 pLX_304 0% 89.7% 89.7% V5 624_625ins108 n/a
3 TRCN0000467059 CCGGAGGTCTCTCACAATCTACTA pLX_317 40.8% 89.7% 89.7% V5 624_625ins108 n/a
Download CSV