Transcript: Human NM_001143915.2

Homo sapiens family with sequence similarity 76 member A (FAM76A), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
FAM76A (199870)
Length:
3339
CDS:
121..804

Additional Resources:

NCBI RefSeq record:
NM_001143915.2
NBCI Gene record:
FAM76A (199870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143915.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000278901 TGAGTGGTGGTGGCCATTATA pLKO_005 455 CDS 100% 15.000 10.500 N FAM76A n/a
2 TRCN0000127668 CGCTCTCTTTCTCTCACTATT pLKO.1 1015 3UTR 100% 13.200 9.240 N FAM76A n/a
3 TRCN0000129419 GAGTACCAGCAGGAGAGTAAA pLKO.1 250 CDS 100% 13.200 9.240 N FAM76A n/a
4 TRCN0000278897 GAGTACCAGCAGGAGAGTAAA pLKO_005 250 CDS 100% 13.200 9.240 N FAM76A n/a
5 TRCN0000129594 CCTTCATTGCATCCTGCCATA pLKO.1 1190 3UTR 100% 4.050 2.835 N FAM76A n/a
6 TRCN0000131026 CCACTTTGTCATCATTGCCCA pLKO.1 519 CDS 100% 0.660 0.462 N FAM76A n/a
7 TRCN0000128084 CAGAGAAGTCAGGAGCTATAA pLKO.1 773 CDS 100% 13.200 7.920 N FAM76A n/a
8 TRCN0000278898 CAGAGAAGTCAGGAGCTATAA pLKO_005 773 CDS 100% 13.200 7.920 N FAM76A n/a
9 TRCN0000278899 CTCTCTTTCTCTCACTATTAG pLKO_005 1017 3UTR 100% 13.200 7.920 N FAM76A n/a
10 TRCN0000128470 GCTCTCTTTCTCTCACTATTA pLKO.1 1016 3UTR 100% 13.200 7.920 N FAM76A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143915.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05182 pDONR223 100% 73.9% 73.9% None 200_201ins153;355_356ins87 n/a
2 ccsbBroad304_05182 pLX_304 0% 73.9% 73.9% V5 200_201ins153;355_356ins87 n/a
3 TRCN0000473578 AGACAATCCTCTACTTCCCTGTGC pLX_317 50.3% 73.9% 73.9% V5 200_201ins153;355_356ins87 n/a
Download CSV