Transcript: Human NM_001143943.1

Homo sapiens EF-hand calcium binding domain 2 (EFCAB2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-20
Taxon:
Homo sapiens (human)
Gene:
EFCAB2 (84288)
Length:
3772
CDS:
91..492

Additional Resources:

NCBI RefSeq record:
NM_001143943.1
NBCI Gene record:
EFCAB2 (84288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056438 GAGTCGAATAATACAGTGGAT pLKO.1 175 CDS 100% 2.640 3.696 N EFCAB2 n/a
2 TRCN0000056439 GATTCAGCTAAACGTGGGTTT pLKO.1 403 CDS 100% 4.050 3.240 N EFCAB2 n/a
3 TRCN0000056440 CTTCCGGTGATGACAGAAATA pLKO.1 319 CDS 100% 13.200 9.240 N EFCAB2 n/a
4 TRCN0000056441 TGGAACAATTATCAGGTCATT pLKO.1 207 CDS 100% 4.950 3.465 N EFCAB2 n/a
5 TRCN0000134716 GCCTGGCTAATTTCTGTATTT pLKO.1 600 3UTR 100% 13.200 6.600 Y LRRC19 n/a
6 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 667 3UTR 100% 4.950 2.475 Y LOC387873 n/a
7 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 701 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
8 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 701 3UTR 100% 1.080 0.540 Y TNNI1 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2575 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2575 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09177 pDONR223 100% 79.6% 73.5% None (many diffs) n/a
2 ccsbBroad304_09177 pLX_304 0% 79.6% 73.5% V5 (many diffs) n/a
3 TRCN0000475986 GGCTTAACTGACACAGGATACTTT pLX_317 57.9% 79.6% 73.5% V5 (many diffs) n/a
Download CSV