Transcript: Human NM_001144036.1

Homo sapiens transmembrane protein 25 (TMEM25), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-23
Taxon:
Homo sapiens (human)
Gene:
TMEM25 (84866)
Length:
2107
CDS:
175..831

Additional Resources:

NCBI RefSeq record:
NM_001144036.1
NBCI Gene record:
TMEM25 (84866)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144036.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161710 GCCCAGTATTAGCACAAGTTA pLKO.1 1528 3UTR 100% 5.625 7.875 N TMEM25 n/a
2 TRCN0000163932 GCGAGACAGGAGTATTCTCTT pLKO.1 839 3UTR 100% 4.950 6.930 N TMEM25 n/a
3 TRCN0000164531 CCAGTGCTGGGCTATATCTAT pLKO.1 772 CDS 100% 5.625 3.938 N TMEM25 n/a
4 TRCN0000158892 GATATCAAGTGACTCCAACAA pLKO.1 558 CDS 100% 4.950 3.465 N TMEM25 n/a
5 TRCN0000137565 CTCAATGACCTCACTCCAGAT pLKO.1 640 CDS 100% 4.050 2.835 N TMEM25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144036.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09228 pDONR223 100% 67.5% 67% None 70_71ins312;581A>G n/a
2 ccsbBroad304_09228 pLX_304 0% 67.5% 67% V5 70_71ins312;581A>G n/a
3 TRCN0000471803 GTGCACCCAGGGCCGTGACTGGAG pLX_317 37.8% 67.5% 67% V5 70_71ins312;581A>G n/a
Download CSV