Transcript: Human NM_001144038.1

Homo sapiens transmembrane protein 25 (TMEM25), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
TMEM25 (84866)
Length:
1546
CDS:
175..1095

Additional Resources:

NCBI RefSeq record:
NM_001144038.1
NBCI Gene record:
TMEM25 (84866)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144038.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159496 CATCCTTAATGTGCAATTCAA pLKO.1 540 CDS 100% 5.625 7.875 N TMEM25 n/a
2 TRCN0000136661 GAGTTGGAGCCACAAATAGAT pLKO.1 253 CDS 100% 5.625 3.938 N TMEM25 n/a
3 TRCN0000158892 GATATCAAGTGACTCCAACAA pLKO.1 870 CDS 100% 4.950 3.465 N TMEM25 n/a
4 TRCN0000161991 GTGCAATTCAAGCCAGAGATT pLKO.1 550 CDS 100% 4.950 3.465 N TMEM25 n/a
5 TRCN0000137565 CTCAATGACCTCACTCCAGAT pLKO.1 952 CDS 100% 4.050 2.835 N TMEM25 n/a
6 TRCN0000138037 GCCACAAATAGATGGTCAGAC pLKO.1 261 CDS 100% 4.050 2.835 N TMEM25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144038.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09228 pDONR223 100% 91.2% 90% None (many diffs) n/a
2 ccsbBroad304_09228 pLX_304 0% 91.2% 90% V5 (many diffs) n/a
3 TRCN0000471803 GTGCACCCAGGGCCGTGACTGGAG pLX_317 37.8% 91.2% 90% V5 (many diffs) n/a
Download CSV