Transcript: Human NM_001144969.2

Homo sapiens NEDD4 like E3 ubiquitin protein ligase (NEDD4L), transcript variant h, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
NEDD4L (23327)
Length:
8330
CDS:
217..3060

Additional Resources:

NCBI RefSeq record:
NM_001144969.2
NBCI Gene record:
NEDD4L (23327)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144969.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379567 AGCTCGCCAACAGTAACTTTA pLKO_005 1474 CDS 100% 13.200 18.480 N Nedd4l n/a
2 TRCN0000338311 CACTCAACAGGTATAGTATTA pLKO_005 3390 3UTR 100% 13.200 18.480 N NEDD4L n/a
3 TRCN0000086871 GCTCGCCAACAGTAACTTTAT pLKO.1 1475 CDS 100% 13.200 18.480 N Nedd4l n/a
4 TRCN0000350909 GTTGCTGGTCTGGCCGTATTT pLKO_005 2278 CDS 100% 13.200 18.480 N NEDD4L n/a
5 TRCN0000338372 TCTAATCACAGACTCCTATTT pLKO_005 445 CDS 100% 13.200 18.480 N NEDD4L n/a
6 TRCN0000376386 GACAATTTAGGCCGAACTTAC pLKO_005 802 CDS 100% 10.800 15.120 N Nedd4l n/a
7 TRCN0000000906 GCGGATGAGAATAGAGAACTT pLKO.1 346 CDS 100% 4.950 6.930 N NEDD4L n/a
8 TRCN0000338308 GCGGATGAGAATAGAGAACTT pLKO_005 346 CDS 100% 4.950 6.930 N NEDD4L n/a
9 TRCN0000379692 AGAGTCCTATCGGAGAATTAT pLKO_005 2019 CDS 100% 15.000 10.500 N NEDD4L n/a
10 TRCN0000086868 GCAGGCAAAGCCCTTAATAAA pLKO.1 3330 3UTR 100% 15.000 10.500 N Nedd4l n/a
11 TRCN0000379683 GCAGGCAAAGCCCTTAATAAA pLKO_005 3330 3UTR 100% 15.000 10.500 N NEDD4L n/a
12 TRCN0000382415 GGTTGATGTGTACACTAATTA pLKO_005 3270 3UTR 100% 15.000 10.500 N NEDD4L n/a
13 TRCN0000379635 GCCCTTCTTCATTGATCATAA pLKO_005 1668 CDS 100% 13.200 9.240 N NEDD4L n/a
14 TRCN0000381068 CAACCATGGAGCGACCCTATA pLKO_005 551 CDS 100% 10.800 7.560 N NEDD4L n/a
15 TRCN0000000905 CGCCTTGACTTACCTCCATAT pLKO.1 2965 CDS 100% 10.800 7.560 N NEDD4L n/a
16 TRCN0000338309 CGCCTTGACTTACCTCCATAT pLKO_005 2965 CDS 100% 10.800 7.560 N NEDD4L n/a
17 TRCN0000000907 GCGAGTACCTATGAATGGATT pLKO.1 2850 CDS 100% 4.950 3.465 N NEDD4L n/a
18 TRCN0000000908 GTCAGAAATAATGGTCACAAA pLKO.1 2514 CDS 100% 4.950 3.465 N NEDD4L n/a
19 TRCN0000000904 CCTGTTTGTATGCGTTTGCTA pLKO.1 4036 3UTR 100% 3.000 2.100 N NEDD4L n/a
20 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 6532 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
21 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 6296 3UTR 100% 0.495 0.248 Y C11orf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144969.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.