Transcript: Human NM_001145049.1

Homo sapiens GPN-loop GTPase 1 (GPN1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
GPN1 (11321)
Length:
1635
CDS:
135..974

Additional Resources:

NCBI RefSeq record:
NM_001145049.1
NBCI Gene record:
GPN1 (11321)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145049.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047666 GCCCAGAACATGTCCAAATAT pLKO.1 183 CDS 100% 15.000 21.000 N GPN1 n/a
2 TRCN0000331196 GCCCAGAACATGTCCAAATAT pLKO_005 183 CDS 100% 15.000 21.000 N GPN1 n/a
3 TRCN0000047663 CCTGAATATGAACGTCTGAAA pLKO.1 660 CDS 100% 4.950 6.930 N GPN1 n/a
4 TRCN0000299939 CCTGAATATGAACGTCTGAAA pLKO_005 660 CDS 100% 4.950 6.930 N GPN1 n/a
5 TRCN0000047665 CCTTGAATCAAGAGACTACAT pLKO.1 484 CDS 100% 4.950 3.960 N GPN1 n/a
6 TRCN0000299928 CCTTGAATCAAGAGACTACAT pLKO_005 484 CDS 100% 4.950 3.960 N GPN1 n/a
7 TRCN0000047664 GCAGTACATGAAGTTCCCTTT pLKO.1 128 5UTR 100% 4.050 2.835 N GPN1 n/a
8 TRCN0000299987 GCAGTACATGAAGTTCCCTTT pLKO_005 128 5UTR 100% 4.050 2.835 N GPN1 n/a
9 TRCN0000039173 GACCACAGAGTTACAGAGGAA pLKO.1 879 CDS 100% 2.640 1.848 N Gpn1 n/a
10 TRCN0000308879 GACCACAGAGTTACAGAGGAA pLKO_005 879 CDS 100% 2.640 1.848 N Gpn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145049.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11620 pDONR223 100% 74.5% 71.6% None 0_1ins178;26_27ins107 n/a
2 ccsbBroad304_11620 pLX_304 0% 74.5% 71.6% V5 0_1ins178;26_27ins107 n/a
3 TRCN0000470336 GCCGTGAGGGCACGAAACATGGAT pLX_317 40.9% 74.5% 71.6% V5 0_1ins178;26_27ins107 n/a
Download CSV